ID: 942335306_942335313

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 942335306 942335313
Species Human (GRCh38) Human (GRCh38)
Location 2:174878070-174878092 2:174878123-174878145
Sequence CCCCAACAAAGTGCTTGCCATCG CCAAATCTGCCTCAATGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79} {0: 1, 1: 0, 2: 0, 3: 15, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!