|
Left Crispr |
Right Crispr |
| Crispr ID |
942384362 |
942384364 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:175425662-175425684
|
2:175425678-175425700
|
| Sequence |
CCAAACTGAACTTCCAGAGATGA |
GAGATGAAAACTACAATGTCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 6, 2: 32, 3: 131, 4: 499} |
{0: 2, 1: 2, 2: 7, 3: 28, 4: 281} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|