ID: 942438093_942438095

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 942438093 942438095
Species Human (GRCh38) Human (GRCh38)
Location 2:176002574-176002596 2:176002600-176002622
Sequence CCTGAAACTGGTCCTGGTGGTCT ACCGCCGCGCGAGCGAAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 140} {0: 1, 1: 0, 2: 1, 3: 2, 4: 23}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!