ID: 942455663_942455667

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 942455663 942455667
Species Human (GRCh38) Human (GRCh38)
Location 2:176136718-176136740 2:176136738-176136760
Sequence CCGCTCACTCGGTCCGCATCGCC GCCGCCACCTCCGGAGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 40} {0: 1, 1: 1, 2: 3, 3: 33, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!