ID: 942558646_942558652 |
View in Genome Browser |
Spacer: -5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 942558646 | 942558652 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 2:177198147-177198169 | 2:177198165-177198187 |
| Sequence | CCAACGCCAAGCTGTCCGAGCTG | AGCTGGAGGCGGCCCTGCAGCGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 15, 2: 15, 3: 60, 4: 348} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||