ID: 942558646_942558657

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 942558646 942558657
Species Human (GRCh38) Human (GRCh38)
Location 2:177198147-177198169 2:177198186-177198208
Sequence CCAACGCCAAGCTGTCCGAGCTG GGGCCAAGCAAGACATGGCATGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 11, 3: 37, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!