ID: 942584927_942584932

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 942584927 942584932
Species Human (GRCh38) Human (GRCh38)
Location 2:177465628-177465650 2:177465644-177465666
Sequence CCAGGCATCAGCTCCCTACAAGG TACAAGGCTGCTGCTGGACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 51, 3: 130, 4: 365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!