ID: 942632934_942632937

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 942632934 942632937
Species Human (GRCh38) Human (GRCh38)
Location 2:177971605-177971627 2:177971629-177971651
Sequence CCTTTATTGACTGGTCATCCACT TCTAGACAGAGAGAAGGAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 90, 4: 872}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!