ID: 942632935_942632946

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 942632935 942632946
Species Human (GRCh38) Human (GRCh38)
Location 2:177971623-177971645 2:177971658-177971680
Sequence CCACTGTCTAGACAGAGAGAAGG GAAGAGGAAGAGAGAGGGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 84, 3: 917, 4: 6344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!