ID: 942647046_942647049

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 942647046 942647049
Species Human (GRCh38) Human (GRCh38)
Location 2:178123607-178123629 2:178123646-178123668
Sequence CCGAATAGGTGTTTCCTTCATTG AACAGAGTAAGTACCATTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 167} {0: 1, 1: 0, 2: 0, 3: 3, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!