ID: 942649550_942649553

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 942649550 942649553
Species Human (GRCh38) Human (GRCh38)
Location 2:178152218-178152240 2:178152270-178152292
Sequence CCATACTCTTTTGTTTACATGCC TAGTTGCAACAGAAGTTGTACGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 14, 3: 103, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!