ID: 942653982_942653994

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 942653982 942653994
Species Human (GRCh38) Human (GRCh38)
Location 2:178195256-178195278 2:178195291-178195313
Sequence CCCGCTGCTGGCGCCCCTGCAGC CTCCGTCCACTCCCCCGGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!