ID: 942657439_942657442

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 942657439 942657442
Species Human (GRCh38) Human (GRCh38)
Location 2:178229024-178229046 2:178229051-178229073
Sequence CCACATCTGATGAGGGCCTCGTG TTCACAGCATGGCAGAAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 48, 4: 229} {0: 1, 1: 1, 2: 5, 3: 42, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!