ID: 942668584_942668593

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 942668584 942668593
Species Human (GRCh38) Human (GRCh38)
Location 2:178349267-178349289 2:178349310-178349332
Sequence CCAACCCCAACCTTTGTGCAGAT TAGCCACCTCACTGACCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 188} {0: 1, 1: 1, 2: 0, 3: 9, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!