ID: 942707604_942707611

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 942707604 942707611
Species Human (GRCh38) Human (GRCh38)
Location 2:178794229-178794251 2:178794261-178794283
Sequence CCGACCACCTTTTGCTCAGAAAG TCTGGGCCCTGCTGGGCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 227} {0: 1, 1: 1, 2: 2, 3: 46, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!