ID: 942738173_942738179

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 942738173 942738179
Species Human (GRCh38) Human (GRCh38)
Location 2:179140317-179140339 2:179140354-179140376
Sequence CCTAAAATAAGGTCTTTAGGGTG ATATGACTGGTATCCTTATAAGG
Strand - +
Off-target summary No data {0: 1, 1: 19, 2: 49, 3: 135, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!