ID: 942745690_942745697

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 942745690 942745697
Species Human (GRCh38) Human (GRCh38)
Location 2:179229385-179229407 2:179229427-179229449
Sequence CCATTGTTGCTCCTAGTCCTCAG TTTACACCACAGGTCTTCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!