ID: 942831451_942831455 |
View in Genome Browser |
Spacer: 9 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 942831451 | 942831455 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 2:180241091-180241113 | 2:180241123-180241145 |
Sequence | CCAGCTTTTCATCTCATGACACC | TACTTAAACCTATGGTAAACAGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |