ID: 942991234_942991240

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 942991234 942991240
Species Human (GRCh38) Human (GRCh38)
Location 2:182205783-182205805 2:182205822-182205844
Sequence CCCTAAGTACTAATCCTTCTCAG GTAATTAAGTTTGTAATTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 115} {0: 1, 1: 0, 2: 1, 3: 29, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!