ID: 943033875_943033888

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 943033875 943033888
Species Human (GRCh38) Human (GRCh38)
Location 2:182716471-182716493 2:182716506-182716528
Sequence CCGCGATGGCAAGGTGGGCATGG GGCTTTGCTGGAGCCGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 154} {0: 1, 1: 0, 2: 4, 3: 35, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!