ID: 943050835_943050837

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 943050835 943050837
Species Human (GRCh38) Human (GRCh38)
Location 2:182911083-182911105 2:182911107-182911129
Sequence CCATTAGGTGTTCTTTCCTAAGA TTAAACAGAAACCAGCCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 30, 4: 238} {0: 10, 1: 9, 2: 13, 3: 40, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!