ID: 943140107_943140111

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 943140107 943140111
Species Human (GRCh38) Human (GRCh38)
Location 2:183971568-183971590 2:183971599-183971621
Sequence CCTGTTTTTCTAATTGAATGCCC CTTCTCCTGCCTGATTGCCCTGG
Strand - +
Off-target summary No data {0: 2758, 1: 5884, 2: 4851, 3: 4196, 4: 4617}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!