ID: 943185149_943185167

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 943185149 943185167
Species Human (GRCh38) Human (GRCh38)
Location 2:184598264-184598286 2:184598315-184598337
Sequence CCACCTTCCAGGAGTCTCCCACT CTGCGGCAGCGGCGCCGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 302} {0: 1, 1: 0, 2: 4, 3: 40, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!