ID: 943275201_943275208

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 943275201 943275208
Species Human (GRCh38) Human (GRCh38)
Location 2:185857957-185857979 2:185857996-185858018
Sequence CCTATTTCCCAATAAAGCCACAT TTGAAACTTTAACTATTTTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!