ID: 943297179_943297188

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 943297179 943297188
Species Human (GRCh38) Human (GRCh38)
Location 2:186154168-186154190 2:186154207-186154229
Sequence CCCAGATGGGGTGGCTGCCGGGC TCTCACACGGGGCAGCTGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 216, 2: 514, 3: 1107, 4: 2803}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!