ID: 943351353_943351355

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 943351353 943351355
Species Human (GRCh38) Human (GRCh38)
Location 2:186799958-186799980 2:186799997-186800019
Sequence CCTCTGACTTATAAGTGAACATG GTTTCTGCATTAGTTTTCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 167} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!