ID: 943384060_943384064

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 943384060 943384064
Species Human (GRCh38) Human (GRCh38)
Location 2:187181071-187181093 2:187181108-187181130
Sequence CCACCAAAGCCCAGTAACAGGTA AAAAAGAGCATAGCTATCTGTGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 168, 3: 176, 4: 222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!