ID: 943479011_943479021

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 943479011 943479021
Species Human (GRCh38) Human (GRCh38)
Location 2:188395341-188395363 2:188395384-188395406
Sequence CCTGGCGTGCACTCCACCTGTGG GTTCCAGAAAGGCTGTCCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 11, 3: 49, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!