ID: 943479427_943479434

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 943479427 943479434
Species Human (GRCh38) Human (GRCh38)
Location 2:188399433-188399455 2:188399472-188399494
Sequence CCTGTACTAGGAGAGAGTAGGTC AGTTCTGGAACCAAGACGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 58} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!