ID: 943498594_943498596

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 943498594 943498596
Species Human (GRCh38) Human (GRCh38)
Location 2:188656455-188656477 2:188656478-188656500
Sequence CCTTAGATCTTCAAAGTGAACAA CACGAACACTGACAAGCTCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!