ID: 943515501_943515508

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 943515501 943515508
Species Human (GRCh38) Human (GRCh38)
Location 2:188880976-188880998 2:188881022-188881044
Sequence CCATTCTGTGGTATTTTGTTATA CTGTTAACTCTGAGGGATGAGGG
Strand - +
Off-target summary {0: 7, 1: 161, 2: 1163, 3: 3377, 4: 6158} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!