ID: 943639541_943639558

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 943639541 943639558
Species Human (GRCh38) Human (GRCh38)
Location 2:190343642-190343664 2:190343691-190343713
Sequence CCGGGAGCCCCGAGGCGGCAGCG GAAAGCCGGGGGCGGCGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 278} {0: 1, 1: 1, 2: 4, 3: 26, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!