ID: 943786338_943786346

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 943786338 943786346
Species Human (GRCh38) Human (GRCh38)
Location 2:191882046-191882068 2:191882087-191882109
Sequence CCTCATAGGCCTCGGCGATCTCC CCGGGCTCCTTGTTCTTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!