ID: 943818689_943818692

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 943818689 943818692
Species Human (GRCh38) Human (GRCh38)
Location 2:192290411-192290433 2:192290459-192290481
Sequence CCTGAAGTGTCTACTCCATAATC AAACCCTGCTTCACAAAGATAGG
Strand - +
Off-target summary No data {0: 20, 1: 32, 2: 26, 3: 28, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!