ID: 943843693_943843699

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 943843693 943843699
Species Human (GRCh38) Human (GRCh38)
Location 2:192613283-192613305 2:192613336-192613358
Sequence CCTGCTGTTGGTGCATCCAACCT GTGTGCTTACTGAGGGAAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!