ID: 943888650_943888653

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 943888650 943888653
Species Human (GRCh38) Human (GRCh38)
Location 2:193256503-193256525 2:193256516-193256538
Sequence CCCCAGATCTACAGAAAATGCAC GAAAATGCACAGATATTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 59, 4: 1531} {0: 1, 1: 0, 2: 3, 3: 22, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!