|
Left Crispr |
Right Crispr |
Crispr ID |
944057968 |
944057975 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:195543437-195543459
|
2:195543482-195543504
|
Sequence |
CCTGGCCAAGAAAGAAATCATCT |
GGCACTAATCCCATTCATGAGGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 378, 1: 1063, 2: 1820, 3: 1960, 4: 1822} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|