ID: 944086297_944086303

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 944086297 944086303
Species Human (GRCh38) Human (GRCh38)
Location 2:195851369-195851391 2:195851404-195851426
Sequence CCTTCAAGCCTTCACAGAGATGA TGAAGTGACTACTTGAATCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 27, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!