ID: 944172976_944172985

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 944172976 944172985
Species Human (GRCh38) Human (GRCh38)
Location 2:196799736-196799758 2:196799780-196799802
Sequence CCCGGTCTGCGCCGCAGCTGCAG CCAGACCGGGACGTATAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 183} {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!