ID: 944250984_944250993 |
View in Genome Browser |
Spacer: 19 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 944250984 | 944250993 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 2:197580046-197580068 | 2:197580088-197580110 |
| Sequence | CCCAGCCCAGTTCATGGCCCACT | CTTTACCGCCCTAGACCCAGAGG |
| Strand | - | + |
| Off-target summary | {0: 8, 1: 56, 2: 157, 3: 266, 4: 417} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||