ID: 944250985_944250995

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 944250985 944250995
Species Human (GRCh38) Human (GRCh38)
Location 2:197580047-197580069 2:197580090-197580112
Sequence CCAGCCCAGTTCATGGCCCACTT TTACCGCCCTAGACCCAGAGGGG
Strand - +
Off-target summary {0: 8, 1: 55, 2: 152, 3: 264, 4: 435} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!