ID: 944250987_944250995

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 944250987 944250995
Species Human (GRCh38) Human (GRCh38)
Location 2:197580051-197580073 2:197580090-197580112
Sequence CCCAGTTCATGGCCCACTTGGCA TTACCGCCCTAGACCCAGAGGGG
Strand - +
Off-target summary {0: 3, 1: 46, 2: 147, 3: 292, 4: 375} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!