ID: 944250987_944250995 |
View in Genome Browser |
Spacer: 16 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 944250987 | 944250995 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 2:197580051-197580073 | 2:197580090-197580112 |
Sequence | CCCAGTTCATGGCCCACTTGGCA | TTACCGCCCTAGACCCAGAGGGG |
Strand | - | + |
Off-target summary | {0: 3, 1: 46, 2: 147, 3: 292, 4: 375} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |