ID: 944250990_944250996

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 944250990 944250996
Species Human (GRCh38) Human (GRCh38)
Location 2:197580064-197580086 2:197580091-197580113
Sequence CCACTTGGCAACAACCCTTAGAT TACCGCCCTAGACCCAGAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!