ID: 944311381_944311383

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 944311381 944311383
Species Human (GRCh38) Human (GRCh38)
Location 2:198237381-198237403 2:198237414-198237436
Sequence CCAGGCTGGAATGCAGTGGCTAT GATCATAGTGCACCACAGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 13, 3: 89, 4: 561}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!