ID: 944437856_944437859 |
View in Genome Browser |
Spacer: 17 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 944437856 | 944437859 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 2:199710291-199710313 | 2:199710331-199710353 |
| Sequence | CCTTATGGAGAGAATATATGAGT | GGTGTGAGTTATGGTGCTGTTGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 4, 3: 59, 4: 287} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||