ID: 944457697_944457706

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 944457697 944457706
Species Human (GRCh38) Human (GRCh38)
Location 2:199911936-199911958 2:199911961-199911983
Sequence CCTTCCACGCCCTTGGCGCCCTT TCCATAGAACCCCATGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122} {0: 1, 1: 0, 2: 2, 3: 17, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!