ID: 944479729_944479730

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 944479729 944479730
Species Human (GRCh38) Human (GRCh38)
Location 2:200144357-200144379 2:200144384-200144406
Sequence CCACTCTGGGGTCTGGAGGATAG TCTCTTATCACATCTTCACTAGG
Strand - +
Off-target summary {0: 2, 1: 72, 2: 1328, 3: 1978, 4: 1733} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!