ID: 944500346_944500347

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 944500346 944500347
Species Human (GRCh38) Human (GRCh38)
Location 2:200352963-200352985 2:200352987-200353009
Sequence CCAAAGTCTGAACTACTCTGACA CAGCATCTACATGTTGTACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 190} {0: 1, 1: 0, 2: 0, 3: 16, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!