ID: 944512447_944512461

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 944512447 944512461
Species Human (GRCh38) Human (GRCh38)
Location 2:200477876-200477898 2:200477919-200477941
Sequence CCCCGGCGAAGGCAGCACGCTGC CCTTCCGGGGTAGTGTCGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 59} {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!