ID: 944515703_944515718

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 944515703 944515718
Species Human (GRCh38) Human (GRCh38)
Location 2:200509951-200509973 2:200509967-200509989
Sequence CCCGCGCCCGGCTCTTCCGCACC CCGCACCGGGGGGGTGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 218} {0: 1, 1: 0, 2: 0, 3: 25, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!